Estudio de las enfermedades parasitarias más frecuentes que afectan a la población rural de Panamá



Descargar 60.62 Kb.
Fecha de conversión05.04.2018
Tamaño60.62 Kb.
Instituto Conmemorativo Gorgas de Estudios de la Salud

Proyecto de Investigación




Estudio de las enfermedades parasitarias más frecuentes que afectan a la población rural de Panamá 

Dr. Azael Saldaña Patiño



Investigador Principal

Departamento de Parasitología. ICGES

Licda. Aracelis Miranda



Investigadora

Departamento de Parasitología. ICGES

Licd. Kadir González



Investigador

Departamento de Parasitología. ICGES

Licda. Vanessa Pineda



Investigadora

Departamento de Parasitología. ICGES

Dr. Franklin Samudio



Investigador

Departamento de Parasitología. ICGES

Dr. José Eduardo Calzada



Investigador

Departamento de Parasitología. ICGES




Febrero 25 de 2016

Título de la Investigación: Estudio de las enfermedades parasitarias más frecuentes que afectan a la población rural de Panamá 


Azael Saldaña, Aracelis Miranda, Kadir González, Vanessa Pineda, Franklin Samudio, José Calzada

Departamento de Investigaciones en Parasitología, Instituto Conmemorativo Gorgas de Estudios en Salud (ICGES).

Resumen:

En Panamá se presenta una amplia variedad de enfermedades parasitarias, afectan con frecuencia a poblaciones vulnerables en el ambiente rural o en territorios indígenas. Estas parasitosis inducen serias consecuencias a la salud: malnutrición, anemia, pobre desarrollo físico y cognitivo, padecimientos cardíacos, lesiones cutáneas crónicas y cuadros clínico febriles que pueden complicarse y terminar fatalmente. Estos graves problemas de salud son una realidad diaria en muchas zonas rurales de nuestro país. Es por ello indispensable realizar investigaciones continuas que promuevan el mejoramiento del diagnóstico, vigilancia, prevención de estas enfermedades, así como la caracterización genética de sus agentes causales.

Este estudio comprende inicialmente la recolección y procesamiento de muestras (sangre, heces, tejidos) en comunidades rurales que presenten altos índices de enfermedades parasitarias. Se realizará la evaluación epidemiológica de las comunidades aplicando encuestas de conocimientos, aptitudes y prácticas sobre las enfermedades parasitarias. Diferentes metodologías moleculares de PCR (dependiendo del agente causal) serán utilizadas para diagnosticar y determinar los genotipos de los parásitos intestinales, tripanosomas, leishmanias y plasmodiums más frecuentes en los sitios evaluados. Con esta información se propone desarrollar mejores técnicas diagnósticas y medidas de control y vigilancia de estas enfermedades. Se capacitarán a los laboratorios clínicos más cercanos a las áreas endémicas con las nuevas metodologías desarrolladas para mejorar el diagnóstico de estas enfermedades en Panamá. Los resultados serán presentados a las autoridades de salud del país para en forma conjunta diseñar y/o reorientar las estrategias de control y prevención de estas parasitosis.
Planteamiento del Problema:

Las enfermedades parasitarias son una causa importante de morbilidad y mortalidad en las regiones rurales de Panamá. En su mayoría estos padecimientos están ligados a condiciones de pobreza que agravan aun más las consecuencias de estas infecciones, debido a la falta de atención médica, pobres condiciones higiénicas, poca disponibilidad de alimentos y escasa educación sanitaria. A pesar de que Panamá es un país pequeño con apenas 4 millones de habitantes, presenta tasas de infección con enfermedades parasitarias que sobresalen en la región. Por ejemplo, la presencia de parásitos intestinales puede afectar hasta el 75% de los habitantes de ciertas comunidades indígenas. Por lo general en el ambiente rural, la poca disponibilidad de agua potable y las deficientes condiciones higiénicas contribuye a que las parasitosis intestinales tengan prevalencias de entre 10-40% principalmente en la población infantil. Se estima que existen en Panamá cerca de 18,000 personas infectadas con Trypanosoma cruzi, el agente causal de la enfermedad de Chagas. De hecho, alrededor de 13.12% de la población total del país vive en áreas de riesgo y más de 3,500 personas infectadas padecen de cardiopatías que no tienen una cura hasta ahora. A su vez, se reportan cerca de 3 mil casos nuevos de leishmaniasis cutánea todos los años, aun con un sub-registro superior al 50%, esto representa la tasa más alta de América Latina. Por otra parte, anualmente se reporta cerca de 1000 casos de malaria, casi todos asociados a comunidades indígenas en donde el establecimiento de las medidas de prevención resulta difícil.

La lucha contra estos problemas es una tarea de difícil ejecución por parte del Estado panameño. Mejorar las condiciones socioeconómicas, el tipo de vivienda, disponibilidad de agua potable, medidas sanitarias básicas, atención médica continúa, disponibilidad de tratamientos, etc. son acciones que cuestan millones de Balboas anualmente. En este sentido, los estudios científicos de estas enfermedades, orientados para mejorar nuestro conocimiento y desarrollar intervenciones de control y vigilancia coherentes con la realidad panameña, representan una herramienta útil para apoyar y aliviar en muchos casos las acciones gubernamentales antes descritas.
Justificación y uso de los resultados:

Panamá es un país tropical, con numerosas áreas rurales caracterizadas por poblaciones pobres, desamparadas socialmente y expuestas a una gran variedad de patógenos que incluyen a parásitos de todo tipo. La lucha contra las enfermedades parasitarias requiere de costosas inversiones en establecimiento y mejora de infraestructuras, disponibilidad permanente de atención médica y de programas continuos de educación sanitaria. Los grandes avances logrados durante los últimos años en la biología molecular (estudio de las características genéticas de los parásitos) han repercutido positivamente en las investigaciones científicas de las enfermedades parasitarias. Actualmente este tipo de abordaje son considerados fundamentales para mejorar las metodologías diagnósticas y el conocimiento sobre la taxonomía, epidemiología, y biología general de estos organismos. De igual manera, su uso ha promovido el desarrollo de intervenciones de control, vigilancia y prevención coherentes con la realidad eco-epidemiológica de las poblaciones rurales afectadas. El tipo de estudio aquí presentado, representa entonces una acción directa que apoya y alivia en muchos casos los programas gubernamentales dirigidos a la mejora de la calidad de vida en estas comunidades apartadas en donde con frecuencia son los niños y niñas los más afectados.


Fundamento Teórico:

Las enfermedades parasitarias son inherentes a las regiones cálidas y la mayoría de ellas se concentran en poblaciones marginadas, como la población rural y la indígena. En general estas enfermedades están ligadas con condiciones económicas bajas, ambientes sanitarios deficientes y pobre educación en general. Esta situación agrava la desigualdad social y económica, perpetuando el ciclo de la pobreza en estás áreas. Algunas de ellas son transmitidas por vectores y están asociadas a la presencia de animales silvestres y/o domésticos. Muchas de estas infecciones (por ejemplo, la enfermedad de Chagas y la leishmaniasis) estaban presentes en nuestros bosques antes de la llegada del ser humano y el establecimiento de comunidades formales. Otras son el producto de la migración de personas infectadas a nuestras áreas en donde encontraron las condiciones ecológicas y epidemiológicas apropiadas para su establecimiento. Este es el caso de la malaria y la mayoría de las enfermedades parasitarias intestinales. Panamá es un país relativamente pequeño, con cerca de 4 millones de habitantes y con un crecimiento económico actual que oscila el 6%, considerado como uno de los mejores de América Latina. Sin embargo, las desigualdades sociales son muy evidentes. Las condiciones sanitarias presentes en las ciudades distan mucho de las observadas en áreas rurales o poblaciones indígenas marcadas con situaciones de pobreza o pobreza extrema. En Panamá, aproximadamente 4 de cada 10 personas viven en pobreza total (36.8%) y, del total de la población, el 16.6%, o sea 508,700 panameños se encuentran en situación de pobreza extrema. En las áreas urbanas del país la pobreza total y la extrema alcanzan su menor nivel, 20.0% y 4.4% de su población, respectivamente. En las áreas rurales no indígenas poco más de la mitad de los residentes es pobre (54.0%) y una de cada cinco personas (22.0%) se encuentra en situación de pobreza extrema. La peor situación se observa en las áreas rurales indígenas dónde casi la totalidad de sus habitantes es pobre (98.4%) y el 90% de sus pobladores viven en pobreza extrema. La pobreza casi siempre está ligada con problemas de salud, ejemplo de esto son las diferencias en el pobre desarrollo físico en niños de áreas rurales vs niños que viven en la ciudad. A nivel nacional, se reporta un 21.2% de retardo en talla en promedio. Sin embargo, esta cifra aumenta significativamente en poblaciones apartadas: 71.1 % en Ngöbe Bugle, 69.3 % en Kuna Yala y la Comarca Emberá Wounan con un 46.9%. Las enfermedades parasitarias contribuyen significativamente a empeorar estos cuadros de malnutrición infantil. Por otro lado, enfermedades como el mal Chagas, la parasitosis intestinal y la malaria, presentan altas prevalencias casi exclusivamente en regiones rurales, apartadas y la mayoría de las veces desprotegidas socialmente si se comparan con la situación encontrada en las ciudades.

Los estudios científicos basados en abordajes moleculares de las enfermedades parasitarias en Panamá brindan la oportunidad de mejorar estos problemas de salud en muchas regiones rurales del país. En primer caso, contribuirían a definir no sólo las áreas geográficas afectadas, sino también a describir la magnitud del problema. Es una realidad que existen comunidades rurales muy desinformadas en donde la prevalencia de enfermedades como el mal de Chagas y la parasitosis intestinal pasa desapercibida, aun con altas tasas de infección y daños severos a la salud de sus habitantes.

En la actualidad existen más y mejores métodos diagnósticos que facilitan el estudio de la frecuencia de las enfermedades parasitarias. La mayoría de estos métodos no son empleados por las instituciones estatales, esto debido en muchos casos al desconocimiento de los mismos o la duda de su utilidad y rentabilidad en nuestro medio. De igual manera la aplicación de análisis dirigidos a caracterizar epidemiológicamente y genéticamente a los parásitos responsables de estas enfermedades brinda grandes oportunidades para la vigilancia, prevención y control de las mismas. Por ejemplo, la identificación de protozoarios intestinales resistentes al tratamiento comúnmente utilizado en algunas regiones del país es indispensable para cambiar estos esquemas tradicionales y lograr el control de las infecciones en un momento dado. El estudio de las características moleculares de los parásitos brinda además la oportunidad de conocer en detalle sus ciclos de transmisión, efectos directos en la salud humana y relaciones filogenéticas con parásitos cercanos.

La situación actual de las enfermedades parasitarias en comunidades rurales de Panamá es preocupante en el mejor de los casos, y aun desconocida en muchas regiones en donde sin duda afecta la salud de sus habitantes. Es un hecho que las acciones tradicionales actuales por si solas no han logrado mejoras importantes en este problema de salud. Se hace necesario un apoyo de investigaciones científicas que orienten a la aplicación de medidas apropiadas en cada situación particular y disminuya o elimine la frecuencia de estas enfermedades en la población rural panameña.
•Hipótesis de Trabajo:

Hi: Los estudios de las enfermedades parasitarias más frecuentes en áreas rurales panameñas, permitirán mejorar nuestros conocimientos sobre la eco-epidemiología de estas infecciones, así como la implementación de mejores medidas de diagnóstico, prevención, control y vigilancia.

Hu: Los estudios de las enfermedades parasitarias más frecuentes en áreas rurales panameñas, no permitirán mejorar nuestros conocimientos sobre la eco-epidemiología de estas infecciones, así como la implementación de mejores medidas de diagnóstico, prevención, control y vigilancia.
•Variable dependiente:

–Infección parasitaria

•Variables independientes:

–Etapas de crecimiento y desarrollo (edad)

–Procedencia (Provincia, Distrito, Corregimiento, barrio)

–Sexo (femenino, masculino)

-Cuadro clínico inducido

–Especie de parásito

-Genotipo del parásito

Objetivo General:


  • Estudiar las características eco-epidemiológicas de las enfermedades parasitarias más frecuentes que afectan a las poblaciones rurales en Panamá, con el fin de reducir o eliminar la frecuencia de estos problemas de salud.

Objetivos Específicos:

  • Detectar nuevas regiones endémicas y mejorar la vigilancia activa de casos enfermedades parasitarias en Panamá




  • Diagnosticar y caracterizar molecularmente parásitos intestinales y otros protozoarios aislados de pacientes provenientes de áreas rurales del país a fin de evaluar su asociación con malnutrición y otras variables clínico- epidemiológicas.




  • Capacitar y entrenar nuevos investigadores y laboratoristas clínicos panameños interesados en el estudio de parasitosis de importancia en salud pública en Panamá, contribuyendo de esta manera al enriquecimiento del conocimiento técnico y científico del país.



Metodología:
Definición operacional de las variables

Variables dependientes



Variable

Definición Conceptual

Indicador

Escala de medición

- Enfermedad parasitaria

Infección humana con un organismo parásito

Detección directa o indirecta del parásito en heces, sangre, piel, etc

Cualitativa

Variables independientes



Variable

Definición Conceptual

Indicador

Escala de medición

- Edad

Tiempo transcurrido a partir del nacimiento

Meses, años

Cuantitativa


- Sexo

Condición orgánica masculina o femenina que manifiesta el (la) infante

Niño o niña

Cualitativo


- Procedencia

Área geográfica donde ha vivido durante el último año.

Dimensiones: Corregimiento, barrio, # de casa, etc.

Información (dirección)proporcionada por los padres

Cualitativo


- Época del año

Si la muestra positiva se tomó durante la estación seca o lluviosa.

Dimensiones: Época seca: (Diciembre-Abril) Época lluviosa: (Mayo-Noviembre)

Número de muestras positivas colectadas durante la época seca o lluviosa. Esto dependerá de las condiciones meteorológicas del año en particular (Precipitación pluvial)

Cualitativo


-Especie de parásito

Trypanosoma cruzi, Leishmania spp, Giardia duodenalis, Cryptosporidium spp, Necator americanus, Ascaris lumbricoides, Entamoeba histolytica, Plasmodium vivax, Plasmodium falciparum u otras

Resultado de prueba de laboratorio (microscopía, serología, PCR)

Cualitativo

-Genotipo de parásito

A, B, C, D, E, F

Resultado de secuenciación

Resultado de PCR-RFLP



Cualitativo

-Cuadro clínico

Todos los síntomas y signos clínicos del paciente. Pueden variar mucho de una enfermedad parasitaria a otra aunque algunos son característicos de ciertas patologías.

Resultado de la evaluación médica y de pruebas diagnósticas particulares

Cualitativo



Tipo de estudio y diseño general

Se realizará un estudio prospectivo, transversal, descriptivo. Las áreas de estudios serán zonas rurales de diferentes regiones del país (Panamá metro, La Chorerra, Chepo, Cañazas/Veraguas, San Félix/Chiriquí, Darién.)


Universo de estudio, selección y tamaño de muestra, unidad de análisis y observación.

El universo de estudio serán los habitantes de comunidades rurales en donde las enfermedades parasitarias son endémicas. En todos los casos, luego de explicarle brevemente el estudio (por personal del equipo de investigación), se solicitará la firma de un consentimiento informado para que sus muestras de sangre, heces y/o tejidos o la de sus hijos o acudidos formen parte de la investigación. Se espera analizar cerca de 300 muestras anuales de personas que residan en los sitios investigados


.


Criterios de inclusión

Vivir en una comunidad rural, edad superior a los 2 años, no haber recibido tratamiento antiparasitarios durante el último mes, con consentimiento informado firmado.


Criterios de exclusión

No vivir en una comunidad rural, edad inferior a los 2 años, haber recibido tratamiento antiparasitarios durante el último mes, sin consentimiento informado firmado.



Procedimientos para la recolección de información, instrumentos a utilizar y métodos para el control y calidad de los datos

Otras variables independientes como fecha, edad, sexo y procedencia geográfica dentro del área bajo estudio serán requeridas y analizadas. Estos datos son proporcionados habitualmente por los habitantes de las comunidades al momento de la colecta de las muestras.

En el caso de las muestras de heces, las mismas se dividirán en dos partes, la primera se mezclará con un volumen igual de formalina al 5% y la segunda se congelará a –20°C o se mezclará con etanol 70%. Las muestras congeladas serán transportadas en neveras provistas con hielo seco al ICGES donde serán almacenadas a –20°C hasta su procesamiento. Las muestras preservadas en etanol 70% serán almacenadas a 4 ºC. Las muestras preservadas con formalina al 5% se transportarán y almacenarán a temperatura ambiente.

Las muestras de heces conservadas en formalina serán objeto de exámenes microscópicos por concentración (Acetato de etilo). La identidad de los huevos, larvas, adultos, quistes, ooquistes o trofozoítos encontrados serán reportados cuidadosamente.

Para aquellas muestras positivas a G. lamblia o Cryptosporidium spp se propone la identificación de las especies y genotipos. La metodología a utilizar para identificar las especies de Cryptosporidium es la de un PCR anidado para la amplificación del gen SSU rRNA (Subunidad pequeña del gen de RNA ribosómico) seguido de un análisis de Polimorfismos en la Longitud de los Fragmentos de Restricción (RFLP) (Xiao y col. 1999, 2001, 2004; Nagamani y col. 2007). Los productos digeridos serán fraccionados en un gel de agarosa al 2% conteniendo bromuro de etidio. Cada perfil electroforético de una muestra analizada será comparado con patrones de ADN controles de diferentes especies de Cryptosporidium. Para aquellos patrones dudosos o diferentes se contempla la posibilidad de secuenciar en ambas direcciones un fragmento del gen SSU rRNA. Los subtipos de C. parvum serán detectados mediante un protocolo descrito previamente por Alves y Col (2003). Para ello un fragmento del gen GP60 (800 -850 pb) se amplificará mediante PCR anidado con los primers AL3531 (5′-ATA GTC TCC GCT GTA TTC-3′) y AL3535 (5′-GGA AGG AAC GAT GTA TCT-3′) en el PCR inicial y con los primers AL3532 (5′-TCC GCT GTA TTC TCA GCC-3′) y AL3534 (5′-GCA GAG GAA CCA GCA TC-3′) in el PCR secundario. Las secuencias obtenidas serán comparadas con todas las existentes en el GenBank, EMBL, DDBJ y PDB. Una metodología similar será realizada para la identificación de los genotipos de G. lamblia, en este caso se amplificará el gen tpi (Sulaiman et al. (2003). Para el diagnóstico de E. histolytica se utilizará el protocolo descrito por Rivero Z. y col. (2009) utilizando los siguientes primers SRPEh 5\’-> CTT GAA AAG CTT GAA GAA GCT G 3\’; 3\’AAC AAT GAA TGG ACT TGA TGC A -<5\’; y SRPEd 5\’-> GTA GTT CAT CAA ACA CAG GTG A 3\’; 3\’ CAA TAG CCA TAA TGA AAG CAA -<5\ ́


El diagnóstico serológico, en muestras sanguíneas, de la infección chagásica se realizará mediante pruebas de ELISA (Chagatest Wiener Lab., Chagas Stat-Pak-Chembio Lab) y una prueba de Western Blot con antígeno de una aislado panameño de T. cruzi según se describe en Saldaña y col. (2012). El diagnóstico y caracterización molecular de T. cruzi se efectuará siguiendo las metodologías descritas por de Oliveira y col. (2015).
La infección con parásitos causantes de la leishmaniasis tegumentaria serán identificadas inicialmente de raspados o biopsias cutáneas a nivel de género mediante un PCR que tiene como blanco una región conservada del minicírculo KDNA (PCR mkDNA) el cual utiliza los siguientes primers 5'-GGG(GT) AGGGGCGTTCT(G/C)CGAA-3' and 5'-(G/C)(G/C)(G/C)(A/T) CTAT(A/T)TTACAC CAACCCC3' (Oliveira y col. 2005). Para la identificación de las especies de Leishmania se amplificará un fragmento del gen hsp70 (hsp70 pcr) con los primers F25 GGACGCCGGCACGATTKCT R1310 CCTGGTTGTTGTTCAGCCACTC (GRAÇA y col. 2012; Montalvo AM, y col. 2012).
Para la identificación de los pacientes con malaria se utilizarán técnicas microscópicas (frotis y gota gruesa) y análisis por pruebas de PCR para la detección de P. vivax y/o P. falciparum (Calzada y col. 2015, Obaldía y col. 2015)
Los resultados al igual que el resto de las características epidemiológicas encontradas serán presentadas a las autoridades del Ministerio de Salud.
Dentro las variables extrañas que pueden afectar la validez del estudio tenemos las fallas técnicas en los procedimientos de laboratorio (Análisis microscópico y PCR), información no verdadera por parte de los habitantes, la exposición prolongada de las muestras al medio ambiente (más de 24 hrs), tratamientos recientes y no reportados.

Plan de Análisis de los Resultados:
Los datos serán depurados, consolidados, analizados y presentados a fin de obtener información sobre las especies y subespecies de parásitos que circulan en las áreas rurales evaluadas. Para este fin el programa de cómputo Epi-info será utilizado en la confección de gráficos, tablas y estadística básica que facilite la presentación y análisis de los resultados.

Los resultados sobre las especies, subespecies y genotipos encontrados serán presentados en tablas y gráficos y se analizarán mediante distribuciones de frecuencia y porcentajes tomando en consideración las otras variables independientes. Las variables independientes se analizarán con respecto a la distribución de frecuencia de las enfermedades parasitarias:



  • por grupos de edad,

  • por especie de parásito

  • por sexo

  • según la procedencia geográfica

  • comparación de especificidad y sensibilidad de las prueba de PCR con los resultados parasitológicos o inmunológicos

  • según la estación seca y lluviosa

En todo momento será mantenida la confidencialidad de la información de los participantes en el estudio, los resultados finales serán entregados a las autoridades del MINSA y de la CSS así como a las direcciones de las unidades de salud investigadas para que tomen las medidas de prevención, vigilancia, tratamiento y control pertinentes. No se prevén otros aspectos éticos a considerar.



Referencias Bibliografícas:
Cama VA, Bern C, Roberts J, Cabrera L, Sterling CR, Ortega Y, Gilman RH, Xiao L. Cryptosporidium species and subtypes and clinical manifestations in children, Peru Emerg Infect Dis. 2008; 14(10):1567-74.
Calzada JE, Marquez R, Rigg C, Victoria C, De La Cruz M, Chaves LF, Cáceres L.Characterization of a recent malaria outbreak in the autonomous indigenous region of Guna Yala, Panama. Malar J. 2015 Nov 17;14(1):459.
C. K. S. Santos, D. F. Grama, J. E. Limongi et al., “Epidemio- logical, parasitological and molecular aspects of Giardia duo- denalis infection in children attending public daycare centers in southeastern Brazil,” Transactions of the Royal Society of Tropical Medicine and Hygiene, vol. 106, no. 8, pp. 473–479, 2012.
de Oliveira MT, de Assis GF, Oliveira e Silva JC, Machado EM, da Silva GN,

Veloso VM, Macedo AM, Martins HR, de Lana M. Trypanosoma cruzi. Discret Typing

Units (TcII and TcVI) in samples of patients from two municipalities of the

Jequitinhonha Valley, MG, Brazil, using two molecular typing strategies. Parasit



Vectors. 2015 Oct 31;8:568.
Feng Y, Xiao L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin Microbiol Rev. 2011
Graça GC, Volpini AC, Romero GA, Oliveira Neto MP, Hueb M, Porrozzi R, et al. Development and validation of PCR-based assays for diagnosis of American cutaneous leishmaniasis and identification of the parasite species. Mem Inst Oswaldo Cruz. 2012;107:664-74.
Montalvo AM, et al. 2012. Three new sensitive and specific heat-shock protein 70 PCRs for global Leishmania species identification. Eur J Clin Microbio 31: 1453-1461.
Obaldia N 3rd, Baro NK, Calzada JE, Santamaria AM, Daniels R, Wong W, Chang HH, Hamilton EJ, Arevalo-Herrera M, Herrera S, Wirth DF, Hartl DL, Marti M, Volkman SK. Clonal outbreak of Plasmodium falciparum infection in eastern Panama. J Infect Dis. 2015 Apr 1;211(7):1087-96.
Oliveira JG, Novais FO, de Oliveira CI, da Cruz Junior AC, Campos LF, de Rocha AV, et al. Polymerase chain reaction (PCR) is highy sensitive for diagnosis of mucosal leishmaniasis. Acta Trop. 2005;94:55-9.
R. Haque, S. Roy, M. Kabir, S. E. Stroup, D. Mondal, and E. R. Houpt, “Giardia assemblage A infection and diarrhea in Bangladesh,” Journal of Infectious Diseases, vol. 192, no. 12, pp. 2171–2173, 2005.
Rivero Z, Bracho A, Calchi M, Díaz I, Acurero E, Maldonado A, Chourio G, Arráiz N, Corzo G. [Detection and differentiation of Entamoeba histolytica and Entamoeba dispar by polymerase chain reaction in a community in Zulia State, Venezuela]. Cad Saude Publica. 2009 Jan;25(1):151-9.
R. C. A. Thompson and P. Monis, “Giardia-from genome to proteome,” Advances in Parasitology, vol. 78, pp. 57–95, 2012.
Teles CB, Medeiros JF, dos Santos AP, de Freitas LA, Katsuragawa TH, Cantanhêde LM, Ferreira Rde G, Camarg LM. Molecular characterization of american cutaneous leishmaniasis in the tri-border area of Assis Brasil, Estado de Acre, Brasil.. Rev Inst Med Trop Sao Paulo. 2015 Jul-Aug;57(4):343-7.
Xiao L, Ryan UM. Cryptosporidiosis: an update in molecular epidemiology. Curr Opin Infect Dis. 2004;17:483-490


La base de datos está protegida por derechos de autor ©bazica.org 2016
enviar mensaje

    Página principal