Ministerio de salud del peru



Descargar 1.93 Mb.
Página10/13
Fecha de conversión11.01.2017
Tamaño1.93 Mb.
1   ...   5   6   7   8   9   10   11   12   13
1

538,12

591,93

376,68

465

B358600110259

PRIMER FR51M 5'TTACCATGGAAATGTAT 3'X 250NM

VIALES

538,12

1

538,12

591,93

376,68

466

B358600110258

PRIMER FR51W 5'TTACCATGGAAATGTAA 3'X 250NM

VIALES

538,12

1

538,12

591,93

376,68

467

B358600110333

PRIMER FR59M5'-ATGTTGTAACTGCACG3' X 200NM

VIALES

538,12

1

538,12

591,93

376,68

468

B358600110354

PRIMER FR59W 5'ATGTTGTAACTGCACA 3' X 200NM

VIALES

538,12

1

538,12

591,93

376,68

469

B358600110496

PRIMER GLURP-1 5┤ TGA AAT CGA AGA TGT TCA CAC TGA AC 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

470

B358600110495

PRIMER GLURP-2 5┤ TGT AGG TAC CAC GGG TTC TTG TGG 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

471

B358600110468

PRIMER KASA269WT 5'-GGTGCCGGTATCACCTCGGA-3'

VIALES

538,12

1

538,12

591,93

376,68

472

B358600110469

PRIMER KASA31 5'-CCTTCCATATCGGTCCGACT-3'

VIALES

538,12

1

538,12

591,93

376,68

473

B358600110470

PRIMER KASA51 5'-ATTGAGTCGGAGAACCCCGA-3'

VIALES

538,12

1

538,12

591,93

376,68

474

B358600110471

PRIMER KATG315DMU 5'-GCGATCACCACAGGCATCGAGG3

VIALES

538,12

1

538,12

591,93

376,68

475

B358600110472

PRIMER KATG315MU 5'-GATCACCACCGGCATCGAGG3'

VIALES

538,12

1

538,12

591,93

376,68

476

B358600110473

PRIMER KATG315WT 5'-GATCACCAGCGGCATCGAGG-3'

VIALES

538,12

1

538,12

591,93

376,68

477

B358600110474

PRIMER KATG463MU 5'-AGCCAGATCCTGGCATCGGG-3'

VIALES

538,12

1

538,12

591,93

376,68

478

B358600110475

PRIMER KATG463WT 5'-AGCCAGATCCGGGCATCGGG-3'

VIALES

538,12

1

538,12

591,93

376,68

479

B358600110249

PRIMER M3717 5'CCATTCCTCATGTGTATACAACAC 3'X 200 NANOMOLES

VIALES

538,12

1

538,12

591,93

376,68

480

B358600110001

PRIMER MDR-1 5' GCT ATT GAT TAT AAA AAT AAA GGA C 3'X 250NM (POST PURIFICACION)

VIALES

538,12

1

538,12

591,93

376,68

481

B358600110002

PRIMER MDR-2 5'CCA AAT TTG ATA TTT TCA TAT ATG GAC 3'X 250NM (POST PURIFICACION)

VIALES

538,12

1

538,12

591,93

376,68

482

B358600110492

PRIMER MSP-1A 5┤ GAA GAT GCA GTA TTG ACA GG 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

483

B358600110504

PRIMER MSP-1A 5┤AAG CTT TAG AAG ATG CAG TAT TGA C 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

484

B358600110493

PRIMER MSP-1B 5┤ GAG TTC AAT AGT GAA CAA G 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

485

B358600110497

PRIMER MSP-1B 5┤ATT CAT TAA TTT CTT CAT ATC CAT C 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

486

B358600110494

PRIMER MSP-1C 5┤ CAG CGT AAT ATT TAG CAT CTG 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

487

B358600110486

PRIMER MSP-1H 5┤AAT ATT ATA ATG GTG AAT CAT CTC C 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

488

B358600110487

PRIMER MSP-1I 5┤AGT ATT AAT AAG AAT GAT ATT CCT A 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

489

B358600110488

PRIMER MSP-2 1 5┤ ATG AAG GTA ATT AAA ACA TTG TCT ATT ATA 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

490

B358600110489

PRIMER MSP-2 2 5┤ AAC GAA TTC ATA AAC AAT GCT TAT AAT ATG AGT 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

491

B358600110490

PRIMER MSP-2 3 5┤ GAT GAA TTC TAG AAC CAT GCA TAT GCT CAT GTT 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

492

B358600110491

PRIMER MSP-2 4 5┤ ATA TGG CAA AAG ATA AAA CAA GTG TTG CTG 3┤ X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

493

B358600110239

PRIMER PFMDR 1042 F 5' TATGTCAAGCGGAGTTTTTGC 3' X 200 NANOMOLES

VIALES

538,12

1

538,12

591,93

376,68

494

B358600110240

PRIMER PFMDR 1042 R 5' TCTGAATCTCCTTTTAAGGAC 3' X 200 NANOMOLES

VIALES

538,12

1

538,12

591,93

376,68

495

B358600110234

PRIMER PFMDR 86F 5' ATGGGTAAAGAGCAGAAAGAG 3'X 200 NANOMOLES

VIALES

538,12

1

538,12

591,93

376,68

496

B358600110235

PRIMER PFMDR 86R 5' CGTACCAATTCCTGAACTCAC 3' X 200 NANOMOLES

VIALES

538,12

1

538,12

591,93

376,68

497

B358600110237

PRIMER PFMDR1246F 5' GCTCTAGCTATAGCTATTCTC 3' X 200 NANOMOLES

VIALES

538,12

1

538,12

591,93

376,68

498

B358600110236

PRIMER PFMDR1246R 5' CTACAGCAATCGTTGGAGAAA 3' X 200 NANOMOLES

VIALES

538,12

1

538,12

591,93

376,68

499

B358600110479

PRIMER RPO526WT 5'-GGGTTGACCCACAAGCGC-3'

VIALES

538,12

1

538,12

591,93

376,68

500

B358600110480

PRIMER RPO531MU 5'-AGCGCCGACTGTTGGCGCTG-3'

VIALES

538,12

1

538,12

591,93

376,68

501

B358600110481

PRIMER RPO531WT 5'-AGCGCCGACTGTCGGCGCTG-3'

VIALES

538,12

1

538,12

591,93

376,68

502

B358600150146

PRIMER RPOB516MU 5' - CAA TTC ATG GTC CAG AAC-3' X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

503

B358600150133

PRIMER RPOB516WT 5' - CAA TTC ATG GAC CAG AAC - 3' X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

504

B358600110482

PRIMER RPSL43WT 5'-ACCACTCCGAAGAAGCCGAA-3'

VIALES

538,12

1

538,12

591,93

376,68

505

B358600150141

PRIMER RPSL88WT 5' - CGG GTG AAG GAC CTG CCT -3' X 250 NM

VIALES

538,12

1

538,12

591,93

376,68

506

B358600110483

PRIMER RRS513WT 5'-ACGTGCCAGCAGCCGCG-3'

VIALES

538,12

1

538,12

591,93

376,68

507

B358600110334

PRIMER SP1 5'ATGATGGAACAAGTCTGCGAC-3'X 200 NM NU

VIALES

538,12

1

538,12

591,93

376,68

508

B358600110340

PRIMER SP2 5'ACATTTTATTATTCGTTTTC-3'X 200NM NU

VIALES

538,12

1

538,12

591,93

376,68

509

B358600110484

PRIMER STR31 5'-CTA GAC GCG TCC TGT GCA TG-3' X 250 NM

VIALES

538,12

1

538,12

591,93

376,68

510

B358600110485

PRIMER STR53 5'-TCACCATCGACGAAGCTCCG-3'

VIALES

538,12

1

538,12

591,93

376,68

511

B358600110324

PRIMER TCR D1 5'TGTGCTCATGTGTTTAAACTT 3' X 200NM

VIALES

538,12

1

538,12

591,93

376,68

512

B358600110233

PRIMER TCRD2 5' CAAAACTATAGTTACCAATTTTG 3'X 250 NANOMOLES

VIALES

538,12

1

538,12

591,93

376,68

513

B358600110337

PRIMER TCRP1 5'CCGTTAATAATAAATACACGCAG3' X 250NM

VIALES

538,12

1

538,12

591,93

376,68

514

B358600110231

PRIMER TCRP2 5' CGGATGTTACAAAACTATAGTTACC 3' X 200 NANOMOLES

VIALES

538,12

1

538,12

591,93

376,68

515

B511000070005

PROBETA GRADUADA DE VIDRIO CLASE A X 1000 ML

UNIDAD

153,15

5

765,75

168,47

107,21

516

B511000070009

PROBETA GRADUADA DE VIDRIO CLASE A X 100 ML C/TAPA DE POLIETILENO

UNIDAD

95,60

1

95,60

105,16

66,92

517

B511000070013

PROBETA GRADUADA DE VIDRIO CLASE A X 250 ML

UNIDAD

74,60

3

223,80

82,06

52,22

518

B511000070017

PROBETA GRADUADA DE VIDRIO CLASE A X 500 ML

UNIDAD

106,00

5

530,00

116,60

74,20

519

B511000060159

PROPIPETA DE JEBE CON TRES VALVULAS DE SALIDA

UNIDAD

28,80

4

115,20

31,68

20,16

520

B511000150212

PROTECTOR PARA UV DEL EQUIPO TRANSILUMINADOR DE 47 X 37 CM

UNIDAD

485,00

1

485,00

533,50

339,50

521

B358600060095

PROTEINASA K X 100 MG

FRASCO

736,16

8

5.889,28

809,78

515,31

522

B512000280539

PULVERIZADOR DE VIDRIO BOROSILICATO COMPLETO X 10 ML ESMIRILADO

UNIDAD

706,90

3

2.120,70

777,59

494,83

523

B358600090549

REACTIVO BRADFORD X L

FRASCO

500,00

1

500,00

550,00

350,00

524

B351000020992

REACTIVO PARA PRECIPITACION DE ADN (PELLET PAINT)

VIALES

1.300,00

2

2.600,00

1.430,00

910,00

525

B351000020998

RENOGRAFINA 76: DIATRIZOATE MEGLUMINE 66%, DIATRIZOATE DE SODIO 10% X 100 ML

FRASCO

1.300,00

1

1.300,00

1.430,00

910,00

526

B351000021523

RESINA CHELEX 100, DISODICO, 100-200 MESH X 100 GR

FRASCO

1.550,00

1

1.550,00

1.705,00

1.085,00

527

B512000280550

RESINA PARA DESIONIZADOR ROVIC

UNIDAD

500,00

1

500,00

550,00

350,00

528

B511000150220

REVELADOR PARA PELICULA DE AUTORADIOGRAFIA

GALON

58,80

3

176,40

64,68

41,16

529

B358600100336

RPMI 1640 MEDIUM C/GLUTAMINA Y BICARBONATO X 500ML

FRASCO

217,05

1

217,05

238,76

151,94

530

B358600100337

RPMI 1640 MEDIUM C/L-GLUTAMINA S/BICARBONATO 10.4G/L

FRASCO

157,24

10

1.572,40

172,96

110,07

531

B512000280572

SACABOCADO PARA BIOPSIA DE 2 MM (CJA X 100 UND)

CAJA

400,00

2

800,00

440,00

280,00

532

B512000280573

SACABOCADO PARA BIOPSIA DE 4 MM (CJA X 100 UND.)

CAJA

400,00

2

800,00

440,00

280,00

533

B351000021024

SEPHADEX G 100 X 100 G

FRASCO

424,83

3

1.274,49

467,31

297,38

534

B351000021025

SEPHADEX G-25

FRASCO

320,00

1

320,00

352,00

224,00

535

B351000021026

SEPHADEX G-25 X 500 G

FRASCO

600,00

1

600,00

660,00

420,00

536

B511000150273

SILICONA LIQUIDA EN HEPTANO SIGMACOTE X 100 ML

FRASCO

140,00

2

280,00

154,00

98,00

537

B351000021045

SODIO DIETILBARBITURATO X 100 G

FRASCO

57,98

3

173,94

63,78

40,59

538

B351000021068

SOLUCION HEPARINA 5UI/ML

UNIDAD

18,52

34

629,68

20,37

12,96

539

B351000021495

SOLUCION TAMPON REDOX PH 7 220 MV X 250 ML CON CERTIFICADO

FRASCO

360,00

1

360,00

396,00

252,00

540

B351000021076

SOLUCION TRIPSINA EDTA 100 X 100 ML

FRASCO

238,92

1

238,92

262,81

167,24

541

B358600150147

SONDA RPOB516MD 5'- CAA TTC ATG GGC CAG AAC 3' X 200 NM

VIALES

138,00

1

138,00

151,80

96,60

542

B358600150145

SONDA RPOB516MV 5' - CAA TTC ATG GTC CAG AAC - 3' X 200 NM

VIALES

138,00

1

138,00

151,80

96,60

543

B358600150132

SONDA RPOB516MY 5' - CAA TTC ATG TAC CAG AAC - 3' X 200 NM

VIALES

538,12

1

538,12

591,93

376,68

544

B358600150134

SONDA RPOB526MD 5' - GGG TTG ACC GAC AAG CGC - 3' X 200 NM

VIALES

138,00

1

138,00

151,80

96,60

545

B358600150135

SONDA RPOB526ML 5' - GGG TTG ACC CTC AAG CGC - 3' X 200 NM

VIALES

138,00

1

138,00

151,80

96,60

546

B358600150136

SONDA RPOB526MN 5' - GGG TTG ACC AAC AAG CGC - 3' X 200 NM

VIALES

138,00

1

138,00

151,80

96,60

547

B358600150137

SONDA RPOB526MR 5' - GGG TTG ACC CGC AAG CGC - 3' X 200 NM

VIALES

138,00

1

138,00

151,80

96,60

548

B358600150138

SONDA RPOB526MY 5' - GGG TTG ACC TAC AAG CGC - 3' X 200 NM

VIALES

138,00

1

138,00

151,80

96,60

549

B358600150139

SONDA RPSL43MT 5' - ACC ACT CCG AGG AAG CCG AA - 3' X 250 NM

VIALES

138,00

1

138,00

151,80

96,60

550

B358600150140

SONDA RPSL88MT 5' - CGG GTG AGG GAC CTG - 3' X 250 NM

VIALES

138,00

1

138,00

151,80

96,60

551

B351000021096

SORBENTE SILICA GEL 60 HF 25H-366 X 500 G

FRASCO

356,50

1

356,50

392,15

249,55

552

B351000021097

SORBENTE SILICA GEL 60 L PARA CCF X 500 G

FRASCO

214,90

1

214,90

236,39

150,43

553

B351000021103

SUCROSA X 500 G

FRASCO

150,09

2

300,18

165,10

105,06

554

B358600170051

SUERO BOVINO FETAL CERTIFICADO X 500 ML

FRASCO

1.867,72

1

1.867,72

2.054,49

1.307,40

555

B351000021104

SULFANILAMIDA P.A. X 100 G

FRASCO

202,30

1

202,30

222,53

141,61

556

B351000021110

SULFATO DE AMONIO EXTRAPURO X 5 KG

FRASCO

2.481,20

1

2.481,20

2.729,32

1.736,84

557

B351000021112

SULFATO DE AMONIO P.A. 1 KG

FRASCO

109,24

4

436,96

120,16

76,47

558

B358600010154

SULFATO DE GENTAMICINA X 250 MG

FRASCO

178,02

1

178,02

195,82

124,61

559

B351000021153

SUSTRATO ABTS PEROXIDASA X 1 L

FRASCO

656,80

4

2.627,20

722,48

459,76

560

B351000021154

SUSTRATO ABTS PEROXIDASA X 100 ML (CAJA X 6 UND)

FRASCO

1.905,67

1

1.905,67

2.096,24

1.333,97

561

B351000021160

SUSTRATO O-PHENILENEDIAMINE (OPD) X 5 MG X 50 TABLETAS

CAJA

1.181,43

3

3.544,29

1.299,57

827,00

562

B512000280238

TARJETA FTA PARA IMPREGNAR MANCHAS DE SANGRE FTA GENE CARD X 100 UND.

PAQUETE

1.300,00

1

1.300,00

1.430,00

910,00

563

B511000110002

TERMOMETRO DE VIDRIO -20 A 100░C

UNIDAD

38,60

2

77,20

42,46

27,02

564

B351000021187

THIMEROSAL USP X 10 G

FRASCO

467,81

1

467,81

514,59

327,47

565

B512000280240

TIPS 1000 UL (MAXIMA RECUPERACION) (BOLSA X 1000)

BOLSA

26,20

5

131,00

28,82

18,34

566

B512000280241

TIPS 200 UL (MAXIMA RECUPERACION) (BOLSA X 1000)

BOLSA

55,00

30

1.650,00

60,50

38,50

567

B512000280242

TIPS AMARILLO AUTOCLAVABLE DE 200 UL (BOLSA X 1000)

BOLSA

65,51

5

327,55

72,06

45,86

568

B512000280243

TIPS AMARILLO DE 200 UL (BOLSA X 1000)

BOLSA

55,00

50

2.750,00

60,50

38,50

569

B512000280247

TIPS AMARILLOS AUTOCLAVABLES 10 - 200 UL X 1000 UND

BOLSA

55,00

10

550,00

60,50

38,50

570

B512000280249

TIPS AMARILLOS X 200UL CAJA AUTOCLAVABLE X 96 TIPS

BOLSA

27,00

6

162,00

29,70

18,90

571

B512000280250

TIPS AZULES 10-1000 UL X 1000 UNID

BOLSA

26,20

4

104,80

28,82

18,34

572

B512000280251

TIPS AZULES ESTERILES DE 10UL - 1000UL (PQT. X 1000)

PAQUETE

26,20

6

157,20

28,82

18,34

573

B512000280252

TIPS BLANCO 1 - 20 UL X 1000 UND

BOLSA

98,20

5

491,00

108,02

68,74

574

B512000280256

TIPS CON FILTRO 0,5- 10 UL X 1000 UND

BOLSA

360,72

10

3.607,20

396,79

252,50

575

B512000280259

TIPS CON FILTRO 1-200 UL X 500 UND.

CAJA

267,60

4

1.070,40

294,36

187,32

576

B512000280263

TIPS CON FILTRO AUTOCLAVABLE 0,5 - 10 UL X 1000 UND

BOLSA

360,72

5

1.803,60

396,79

252,50

577

B512000280264

TIPS CON FILTRO AUTOCLAVABLE 1 - 200 UL X 500 UND

CAJA

267,60

6

1.605,60

294,36

187,32

578

B512000280265

TIPS CON FILTRO AUTOCLAVABLE 2 - 20 UL X 500 UND

CAJA

165,00

3

495,00

181,50

115,50

579

B512000280266

TIPS CON FILTRO DE 100 - 1000UL (CJA. X 96)

CAJA

48,42

15

726,30

53,26

33,89

580

B512000280268

TIPS CON FILTRO DE BAJA RETENCION DE 0.5-10UL 96 TIPS/RACK

CAJA

347,78

40

13.911,20

382,56

243,45

581

B512000280271

TIPS CON FILTRO ESTERIL 200 UL, DE BAJA RETENCION, 96 TIPS CON RACK.

CAJA

57,80

40

2.312,00

63,58

40,46

582

B512000280274

TIPS DE 0,5 - 250UL PARA MICROPIPETA FINNEPIPETTE PQTE. X 1000UNDS.

PAQUETE

64,60

2

129,20

71,06

45,22

583

B512000280291

TIPS ESTERILES AMARILLOS DE 1 A 200 UL X 96 UND (CAJA / 96)

CAJA

32,00

20

640,00

35,20

22,40

584

B512000280292

TIPS ESTERILES AZULES DE 200 A 1000 UL X 96 UND. (CAJA / 96)

CAJA

35,00

5

175,00

38,50

24,50

585

B512000280295

TIPS MICROCAPILARES FLAT TIP DE 200 UL X 500 UND.

CAJA

320,00

2

640,00

352,00

224,00

586

B512000280305

TIPS UNIVERSALES 10-200 UL X 1000 UND

BOLSA

76,01

6

456,06

83,61

53,21

587

B512000280308

TIPS UNIVERSALES AMARILLOS DE 1-300UL PARA MICROPIPETA X 1000 U

CAJA

83,39

2

166,78

91,73

58,37

588

B514000590033

TIRA INDICADORA PH 0-14 RANGO 0.2 X 100 UND

CAJA

68,70

4

274,80

75,57

48,09

589

B514000590045

TIRAS DE POLIESTIRENO PARA IMPREGNAR ANTICUERPOS TIPO INMULON II X 12 POCILLOS X 320UND.

CAJA

220,00

5

1.100,00

242,00

154,00

590

B514000590046

TIRAS DE POLIESTIRENO PARA IMPREGNAR ANTIGENO X 8 POZOS

CAJA

220,00

2

440,00

242,00

154,00

591

B351000021515

TOSYL-ARGINIL-ETILESTER (TAME) X 5 GR

FRASCO

400,00

1

400,00

440,00

280,00

592

B351000021214

TRIETANOLAMINA P.A. X 500 ML

FRASCO

324,20

1

324,20

356,62

226,94

593

B351000021224

TRIPSINA EDTA SOLUCION X 100 ML

FRASCO

1.870,33

1

1.870,33

2.057,36

1.309,23

594

B351000021227

TRIS (HIDROCLORURO) PARA ELECTROFORESIS AL 99% 500 G

FRASCO

551,40

2

1.102,80

606,54

385,98

595

B351000021230

TRIS (HIDROXIAMINOMETANO BASE) X KG

FRASCO

532,46

1

532,46

585,71

372,72

596

B351000021232

TRIS (HIDROXIMETIL) AMINOMETANO BASE P.A. X KG

FRASCO

1.075,10

2

2.150,20

1.182,61

752,57

597

B351000021234

TRIS (HIDROXIMETILAMINO METANO CLORIDRATO) X 500 G

FRASCO

606,90

1

606,90

667,59

424,83

598

B351000021236

TRIS BASE LIBRE DE ADNASAS Y ARNASAS X 1 KG

FRASCO

586,67

4

2.346,68

645,34

410,67

599

B351000010028

TRIZMA BASE (TRIS HYDROXIMETIL AMINOMETHANE) X 1 KG

UNIDAD

532,46

1

532,46

585,71

372,72

600

B511000080242

TUBO AL VACIO 13 X 75 C/CITRATO DE SODIO 0,109 M X 100 UNIDADES

CAJA

59,00

5

295,00

64,90

41,30

601

B511000080002

TUBO AL VACIO D/POLIPROPILENO DE 13/100 C/ANTICUAGULANTE EDTA X 100 UND.

CAJA

50,00

35

1.750,00

55,00

35,00

602

B511000080003

TUBO AL VACIO D/POLIPROPILENO DE 13/100 S/ANTICUAGULANTE X 100 UND

CAJA

59,00

94

5.546,00

64,90

41,30

603

B511000080005

TUBO AL VACIO D/POLIPROPILENO DE 16/100 C/ANTICOAGULANTE X 100 UND

CAJA

80,74

4

322,96

88,81

56,52

604

B511000080006

TUBO AL VACIO D/POLIPROPILENO DE 16/100 S/ANTICUAGULANTE X 100 UND.

CAJA

68,00

16

1.088,00

74,80

47,60

605

B511000080009

TUBO AL VACIO D/POLIPROPILENO T/LILA C/ANTICOAGULANTE EDTA X 3ML (CJAX50)

CAJA

49,00

5

245,00

53,90

34,30

606

B511000080013

TUBO AL VACIO DE 5 - 7CC C/EDTA, C/AGUJA N░21X1" Y ADAPTADOR (CJA.X 100)

CAJA

99,00

17

1.683,00

108,90

69,30

607

B511000080027

TUBO AL VACIO DE VIDRIO X 2 ML C/ANTICUAGULANTE EDTA PAQUETE X 100 UND

PAQUETE

49,00

5

245,00

53,90

34,30

608

B511000080030

TUBO CENTRIFUGA 50 ML CORNING

UNIDAD

0,74

10

7,40

0,81

0,52

609

B511000080033

TUBO CENTRIFUGA CONICO GRADUADO DE POLIPROPILENO X 15ML (PQTE X 50)

PAQUETE

186,70

30

5.601,00

205,37

130,69

610

B511000080034

TUBO CENTRIFUGA CONICO GRADUADO DE POLIPROPILENO X 50MLT/R AUTOCLAVABLE (PQTE.X 25)

PAQUETE

62,80

80

5.024,00

69,08

43,96

611

B511000080037

TUBO CENTRIFUGA DE POLIPROPILENO X 1.5 ML (PQTE X 1000UND)

PAQUETE

178,00

4

712,00

195,80

124,60

612

B511000080045

TUBO CENTRIFUGA POLIPROPILENO ESTERIL 15 ML T/R (CJA.X 100)

CAJA

247,60

8

1.980,80

272,36

173,32

613

B511000080046

TUBO CENTRIFUGA POLIPROPILENO ESTERIL 50 ML X 100 UND.

CAJA

74,00

5

370,00

81,40

51,80

614

B511000080056

TUBO DE ENSAYO DE VIDRIO CLASE A 16 X 150 MM BORDE RECTO X 72 UND

CAJA

270,80

2

541,60

297,88

189,56

615

B511000080064

TUBO DE ENSAYO DE VIDRIO CLASE A 20 X 125 MM T/ROSCA X 48 UND

CAJA

12,00

23

276,00

13,20

8,40

616

B511000080066

TUBO DE ENSAYO DE VIDRIO CLASE A 20 X 150 MM BORDE RECTO X 72 UND

CAJA

339,20

8

2.713,60

373,12

237,44

617

B511000080079

TUBO DE ENSAYO DE VIDRIO CLASE A DE 10 X 120 MM

UNIDAD

1,09

700

763,00

1,20

0,76

618

B511000080080

TUBO DE ENSAYO DE VIDRIO CLASE A DE 10 X 75 MM BORDE RECTO

UNIDAD

0,83

300

249,00

0,91

0,58

619

B511000080081

TUBO DE ENSAYO DE VIDRIO CLASE A DE 10 X 75 MM BORDE RECTO X 72 UND

CAJA

185,20

2

370,40

203,72

129,64

620

B511000080083

TUBO DE ENSAYO DE VIDRIO CLASE A DE 13 X 100 MM BORDE RECTO

UNIDAD

0,95

250

237,50

1,05

0,67

621

B511000080084

TUBO DE ENSAYO DE VIDRIO CLASE A DE 13 X 100 MM BORDE RECTO X 72 UND

CAJA

193,90

6

1.163,40

213,29

135,73

622

B511000080089

TUBO DE ENSAYO DE VIDRIO CLASE A DE 16 X 125 MM CON TAPA ROSCA X 144 UND

CAJA

1.408,40

1

1.408,40

1.549,24

985,88

623

B511000080191

TUBO DE MICROCENTRIFUGA DE POLIPROPILENO PARA PCR 0.2ML. X 1000

PAQUETE

233,90

20

4.678,00

257,29

163,73

624

B511000080105

TUBO DE MICRODILUCION DE POLIPROPILENO AUTOCLAVABLE DE 1,1ML X 1000 UND.

BOLSA

306,80

18

5.522,40

337,48

214,76

625

B511000080131

TUBO DE VIDRIO DE 13 MM X 100 C/TAPA ROSCA

UNIDAD

2,17

100

217,00

2,39

1,52

626

B511000080146

TUBO MICROCENTRIFUGA X 0.5ML (BLSA. X 1000)

BOLSA

201,60

5

1.008,00

221,76

141,12

627

B511000080153

TUBO P/ MICROCENTRIFUGA DE 1.5 ML, PQTE X 1000 UND.

PAQUETE

119,90

20

2.398,00

131,89

83,93

628

B511000080338

TUBO PARA MICROCENTRIFUGA DE 1.5 ML X 500 UNIDADES

BOLSA

65,60

8

524,80

72,16

45,92

629

B511000080192

TUBO PARA MICROCENTRIFUGA PARA PCR 0.2

PAQUETE

233,90

8

1.871,20

257,29

163,73

630

B351000010022

TWEEN-20 X 500 ML

FRASCO

228,90

3

686,70

251,79

160,23

631

B351000021246

URACIL DNA GLICOSILASA (100 U)

FRASCO

752,56

5

3.762,80

827,82

526,79

632

B351000021252

UREA GRADO SECUENCIAMIENTO X 500 G

FRASCO

145,33

1

145,33

159,86

101,73

633

B351000021254

UREA PARA ELECTROFORESIS X 1 KG

FRASCO

206,08

3

618,24

226,69

144,26

634

B514000640003

VASO DE PLASTICO CON T/ROSCA X 100 ML

UNIDAD

1,10

500

550,00

1,21

0,77

635

B351000021261

XYLENE CIANOL FF X 10 G

FRASCO

247,50

2

495,00

272,25

173,25

636

B351000021262

XYLENE CIANOL X 50 MG

FRASCO

210,00

1

210,00

231,00

147,00

637

B514000500040

YODURO DE POTASIO P.A X 500 G

FRASCO

712,05

2

1.424,10

783,26

498,44
















1   ...   5   6   7   8   9   10   11   12   13


La base de datos está protegida por derechos de autor ©bazica.org 2016
enviar mensaje

    Página principal