Ministerio de salud del peru



Descargar 1.93 Mb.
Página9/13
Fecha de conversión11.01.2017
Tamaño1.93 Mb.
1   ...   5   6   7   8   9   10   11   12   13
457,36

291,05

407

B358600010136

PENICILINA G SODICA X 10 MILLONES UI.

FRASCO

141,61

3

424,83

155,77

99,13

408

B351000020903

PENTA-HIS HRP CONJUGATE KIT

VIALES

1.800,00

1

1.800,00

1.980,00

1.260,00

409

B351000020906

PEPSINA 1200 U/G X 500 G

FRASCO

902,26

1

902,26

992,49

631,58

410

B358600120083

PEROXIDASA TIPO VI-A LIBRE DE SAL 250-330 UND. X 100MG

FRASCO

1.680,00

1

1.680,00

1.848,00

1.176,00

411

B351000020914

PERSULFATO DE AMONIO 98% X 100 G PARA ELECTROFORESIS

FRASCO

141,30

3

423,90

155,43

98,91

412

B351000020915

PERSULFATO DE AMONIO P.A. X 1 KG

FRASCO

233,91

2

467,82

257,30

163,74

413

B512000280168

PINZA PUNTA PLANA DE ACERO INOXIDABLE 15 CM

UNIDAD

52,50

1

52,50

57,75

36,75

414

B511000060068

PIPETA DE POLIPROP. LINEAL TERMINAL X 10 ML ENV 1X1 (BLS X 200)

BOLSA

206,00

1

206,00

226,60

144,20

415

B511000060072

PIPETA DE POLIPROP. LINEAL TERMINAL X 5 ML ENV 1X1 (CJA X 200)

CAJA

200,00

2

400,00

220,00

140,00

416

B511000060075

PIPETA DE TRANSF. 2 ML/ENV. 1X1 (BLS X 100)

BOLSA

68,00

28

1.904,00

74,80

47,60

417

B511000060079

PIPETA DE TRANSF. D/POLIETILENO X 2 ML/ENV. 1 X 1 (BLS X 100)

BOLSA

135,00

2

270,00

148,50

94,50

418

B511000060080

PIPETA DE TRANSF. DESCARTABLE 1.9 ML ESTERIL CON SOBRE INDIVIDUAL PAQUETE X 500 UND

PAQUETE

340,00

2

680,00

374,00

238,00

419

B511000060081

PIPETA DE TRANSF. DESCARTABLE DE 3 ML X 100 UNDS

BOLSA

135,00

30

4.050,00

148,50

94,50

420

B511000060084

PIPETA DE TRANSF. ESTERIL X 4 ML (CJA X 500 UND)

CAJA

290,85

2

581,70

319,94

203,60

421

B511000060088

PIPETA DE VIDRIO 1 ML 1/100

UNIDAD

11,80

500

5.900,00

12,98

8,26

422

B511000060093

PIPETA DESCARTABLE SEROLOGICA ESTERIL CON ENVOLTURA INDIVIDUAL DE 10 ML X 100 UND.

CAJA

103,00

3

309,00

113,30

72,10

423

B511000060094

PIPETA DESCARTABLE SEROLOGICA ESTERIL CON ENVOLTURA INDIVIDUAL DE 1 ML X 100 UNDS

CAJA

148,00

3

444,00

162,80

103,60

424

B511000060096

PIPETA DESCARTABLE SEROLOGICA ESTERIL CON ENVOLTURA INDIVIDUAL DE 5 ML X 100 UND.

CAJA

134,69

3

404,07

148,16

94,28

425

B511000060097

PIPETA DESCARTABLE SEROLOGICA ESTERIL X 25 ML ENVOLTURA INDIVIDUAL

UNIDAD

493,70

1

493,70

543,07

345,59

426

B511000060107

PIPETA LINEAL GRADUADA DE VIDRIO 1/100 X 1 ML CLASE A

UNIDAD

25,00

24

600,00

27,50

17,50

427

B511000060109

PIPETA LINEAL GRADUADA DE VIDRIO 1/100 X 5 ML CLASE A

UNIDAD

14,99

12

179,88

16,49

10,49

428

B511000060116

PIPETA LINEAL TERMINAL GRADUADA DE VIDRIO CLASE A 1/10 X 10 ML

UNIDAD

8,61

50

430,50

9,47

6,03

429

B511000060121

PIPETA PASTEUR 9" VIDRIO CLASE A (CAJA X 250)

CAJA

32,55

2

65,10

35,81

22,79

430

B511000060145

PIPETA VOLUMETRICA TERMINAL DE VIDRIO CLASE A X 1 ML

UNIDAD

11,80

20

236,00

12,98

8,26

431

B511000060151

PIPETA VOLUMETRICA TERMINAL DE VIDRIO CLASE A X 5 ML

UNIDAD

23,20

10

232,00

25,52

16,24

432

B358600010142

PIRAZINAMIDA X 25G

FRASCO

296,22

1

296,22

325,84

207,35

433

B351000020929

PIRUVATO DE SODIO X 100 MILIMOLES CULTIVO CELULAR X 100 ML

FRASCO

141,61

2

283,22

155,77

99,13

434

B511000060170

PIZETA DE PL┴STICO DE 250ML POLETILENO DE BAJA DENSIDAD CAPACIDAD SIXE 53MM X 6 UND

UNIDAD

137,40

1

137,40

151,14

96,18

435

B511000060171

PIZETA DE POLIETILENO X 1000 ML

UNIDAD

37,00

8

296,00

40,70

25,90

436

B512000220045

PLACA PETRI DESCARTABLE DE 100 X 15 MM DE POLYESTIRENO X 500 UNDS

CAJA

436,00

2

872,00

479,60

305,20

437

B512000210041

PLASTICO PARA MICROONDA

ROLLO

33,00

2

66,00

36,30

23,10

438

B512000280402

PLUMON INDELEBLE PARA FRIO -20 GRADOS CENTIGRADOS

UNIDAD

10,03

20

200,60

11,03

7,02

439

B514000690186

PLUMONES INDELEBLES PARA CRIOVALES X 4 UNDS.

ESTUCHE

48,83

8

390,64

53,71

34,18

440

B351000020887

P-NITROANILINA P/DETERMINAR FENOLES X 50 G

FRASCO

304,80

1

304,80

335,28

213,36

441

B351000020954

POLIACRILAMIDA PARA SECUENCIAMIENTO DE ADN (READY MIX DNA/PAGE)

FRASCO

532,00

4

2.128,00

585,20

372,40

442

B358600010145

POLIMIXINA B SULFATO X 10,000,000 UNID. X 5 G

FRASCO

716,14

1

716,14

787,75

501,30

443

B351000020966

PONCEAU X 100 ML

FRASCO

145,33

3

435,99

159,86

101,73

444

B512000240010

PORTA TIRAS PARA RECIPIENTE TIPO INMULON II X 10

CAJA

230,00

3

690,00

253,00

161,00

445

B511000150205

PORTAFILTRO DE POLIPROPILENO NEGRO, 25 MM, 3 PIEZAS, X 50 UNIDADES

CAJA

500,00

1

500,00

550,00

350,00

446

B358600110247

PRIMER 185 5'TGATACCCGAATATAAGCATAATG 3'X 250NM

VIALES

538,12

1

538,12

591,93

376,68

447

B358600110250

PRIMER 186 5' GTTTAATCACATGTTTGCACTTTC 3'X 200 NANOMOLES

VIALES

538,12

1

538,12

591,93

376,68

448

B358600110253

PRIMER 201 5'AAT AGATTGATCATGTTTCTTCC 3'X 250NM

VIALES

538,12

1

538,12

591,93

376,68

449

B358600110248

PRIMER 218 5' ATAATAGCTGTAGGAAGCAATTG 3' X 200 NANOMOLES

VIALES

538,12

1

538,12

591,93

376,68

450

B358600110254

PRIMER 261 5'CTATTTGATATTGGATTAGGATTTTC 3'X 250NM

VIALES

538,12

1

538,12

591,93

376,68

451

B358600110330

PRIMER AMP15'-TTTATATTTTCTCCTTTTTA-3' X 200NM

VIALES

538,12

1

538,12

591,93

376,68

452

B358600110320

PRIMER AMP2 5'CATTTTATTATTCGTTTTCT-3' X 200 NM NU

VIALES

538,12

1

538,12

591,93

376,68

453

B358600110246

PRIMER D12 5'GGAATGCTTTCCCAGT 3'X 200 NANOMOLES NU

VIALES

538,12

1

538,12

591,93

376,68

454

B358600110244

PRIMER D3 5' GAATGCTTTCCCAGC 3'X 250NM

VIALES

538,12

1

538,12

591,93

376,68

455

B358600110245

PRIMER D9 5' GAATGCTTTCCCAGG 3'X 250NM

VIALES

538,12

1

538,12

591,93

376,68

456

B358600110003

PRIMER DIA13 5'CAA CGG AAC CTC CTA T 3'X 250NM (POST PURIFICACION)

VIALES

538,12

1

538,12

591,93

376,68

457

B358600110004

PRIMER DIA14 5'CAA CGG AAC CTC A 3' X 250NM (POST PURIFICACION)

VIALES

538,12

1

538,12

591,93

376,68

458

B358600110201

PRIMER EAEC AAPF 5' CTT GGG TAT CAG CCT GAA TG 3' X 250 NM

VIALES

538,12

1

538,12

591,93

376,68

459

B358600110202

PRIMER EAEC AAPR 5' AAC CCA TTC GGT TAG AGC AC 3' X 250 NM

VIALES

538,12

1

538,12

591,93

376,68

460

B358600110199

PRIMER EAEC AGGRF 5' CTA ATT GTA CAA TCG ATG TA 3' X 250 NM

VIALES

538,12

1

538,12

591,93

376,68

461

B358600110200

PRIMER EAEC AGGRR 5' AGA GTC CAT CTC TTT GAT AAG 3' X 250 NM

VIALES

538,12

1

538,12

591,93

376,68

462

B358600110115

PRIMER EAECF 5'CTGGCGAAAGACTGTATCAT 3'X 250NM

VIALES

538,12

1

538,12

591,93

376,68

463

B358600110178

PRIMER EAECR 5'CAATGTATAGAAATCCGCTGTT 3'X 250NM

VIALES

538,12

1

538,12

591,93

376,68

464

B358600110467

PRIMER EMBB306WT 5'-CCTGGGCATGGCCCGAGTCG-3'

VIALES

538,12

1   ...   5   6   7   8   9   10   11   12   13


La base de datos está protegida por derechos de autor ©bazica.org 2016
enviar mensaje

    Página principal