Primera convocatoria bases administrativas, terminos de referencia y anexos complementarios adquisicion de reactivos y materiales de laboratorio -investigacion



Descargar 0.74 Mb.
Página5/7
Fecha de conversión11.01.2017
Tamaño0.74 Mb.
1   2   3   4   5   6   7
171

B35530650

KIT PARA PURIFICACION DE PRODUCTOS DE PCR (WIZARD PCR PREPS)x 50 Det. *

KIT

8

414,12

591,60

650,76

4.732,80

172

B35530860

KIT PARA SINTESIS RAPIDA cDNA x 5det (KIT TIMER SAVER cDNA SYNTHESIS x 5det)

KIT

2

2.786,00

3.980,00

4.378,00

7.960,00

173

B35530674

KIT PGEMT EASY VECTOR SYSTEM I x 20 dET. *

KIT

7

569,11

813,01

894,31

5.691,07

174

B35530640

KIT RPR SIFILIS CON CONTROLES (POSITIVO Y NEGATIVO), AGUJA CALIBRADA , TARJETA CON 10 CIRCULOS, x 500det

KIT

1

317,10

453,00

498,30

453,00

175

B35530866

KIT TRIGLICERIDOS GPO/PAP LIQUIDO x 400 ml

KIT

1

560,00

800,00

880,00

800,00

176

B35530491

KIT UREA PARA 500 DETERMINACIONES, METODO COLORIMETRITO

KIT

1

4.200,00

6.000,00

6.600,00

6.000,00

177

B33755097

LAMBD-CYHALOTHRIN 10% PM, SACHETTS x 60 grs. x 100 UND.

CJA

6

1.330,00

1.900,00

2.090,00

11.400,00

178

B35120630

LINEA CELULAR FIBROBLASTOS ATCC CCL-10, BHK-21 (C-13) DE MESOCRICETUS AURATUS, CRIOPRESERVADO

VLS

1

861,00

1.230,00

1.353,00

1.230,00

179

B35830494

LIPASA REAGENT 20mL. x 6Fcos. *

CJA

1

627,90

897,00

986,70

897,00

180

B35830498

LISOSTAPHIN x 5mg.

FCO

2

622,30

889,00

977,90

1.778,00

181

B35560790

LYMPHOCULT-T

VLS

2

315,00

450,00

495,00

900,00

182

B35782455

MALATHION x 1 gr. *

FCO

2

173,54

247,91

272,70

495,82

183

B35300624

MARCADOR DE ACIDO NUCLEICOS (ADN) 1 KB DNA STEP LABDER X 500 UL

VLS

8

342,09

488,69

537,55

3.909,52

184

B35300625

MARCADOR DE PESO MOLECULAR (100pb LADDER) X 250uL.

VLS

20

323,87

462,67

508,93

9.253,40

185

B35300621

MARCADOR DE PESO MOLECULAR DE PROTEINAS A COLOR MODELO PRESTAINED STANDAR X 500 uL RANGO 216000 - 7600 Da

VLS

2

630,00

900,00

990,00

1.800,00

186

B35300627

MARCADOR DE PESO MOLECULAR PARA PFGE 0.5ml

VLS

2

595,00

850,00

935,00

1.700,00

187

B35300612

MARCADOR LAMBDA HIND III x 5 g

FCO

2

553,42

790,60

869,66

1.581,20

188

B35560881

MEDIO MINIMO ESENCIAL EAGLE CON L/GLUTAMINA Y SALES DE EARLE, EN POLVO PARA CULTIVO CELULAR CJA x 10 L

CJA

10

182,00

260,00

286,00

2.600,00

189

B51800387

MEMBRANA DE ULTRAFILTRACION DE CELULOSA REGENERAD, Diam. 25 mm (Pqte x 10 und.)

PQT

1

385,00

550,00

605,00

550,00

190

B51800718

MEMBRANA DE ULTRAFILTRACION x U100 (AMICON)

UND

1

434,00

620,00

682,00

620,00

191

B51800716

MEMBRANA NITROCELLULOSE FOR FLOW - THROUGH ASSAYS PORO 8 um 25 mm x 30 cm 10 PQTY/PKT (CAT 12549886 -SCHLEICHER - SCHUELL)

UND

1

1.470,00

2.100,00

2.310,00

2.100,00

192

B51800715

MEMBRANES NITROCELLULOSE FOR FLOW - THROUGH ASSAYS PORO 8 um 25 mm x 30 cm 10 PQTY/PKT (CAT 12549892 - SCHEICHER - SCHUELL)

PQT

1

1.470,00

2.100,00

2.310,00

2.100,00

193

B35830524

MEZCLA DE NUCLEOTIDOS P/PCR (DNTPS-BLEND 10 mM.) Cja.X 6 U. *

CJA

19

1.001,00

1.430,00

1.573,00

27.170,00

194

B35780682

MEZCLA DE NUCLEOTIDOS TRIFOSFATOS PARA PCR (GENEAMP DNTP BLEND) 10 mM x 1mL.x 6und.

SET

4

1.022,00

1.459,99

1.605,98

5.839,96

195

B35830525

MEZCLA DE NULCEOTIDOS P/PCR MEZCLA DE DNTP x 10mM C/U DE LAS UNIDADES D/DNTP (dATP, dCTP, dGTP, dTTP) Vial x 1ml.

VLS

2

157,50

225,00

247,50

450,00

196

B51800389

MICROCUBETA HEMOCUE (CAJA x 200)

CJA

11

427,00

610,00

671,00

6.710,00

197

B51800398

MICROPIPETA DE RANGO VARIABLE DE 0.1-10 ul.

UND

3

1.050,00

1.500,00

1.650,00

4.500,00

198

B51800724

MICROPIPETA DE RANGO VARIABLE DE 0.2 A 10 UL

UND

1

1.050,00

1.500,00

1.650,00

1.500,00

199

B51800399

MICROPIPETA DE RANGO VARIABLE DE 0.5 - 10 uL *

UND

2

1.050,00

1.500,00

1.650,00

3.000,00

200

B51800401

MICROPIPETA DE RANGO VARIABLE DE 1 A 20 ul *

UND

2

1.050,00

1.500,00

1.650,00

3.000,00

201

B51800402

MICROPIPETA DE RANGO VARIABLE DE 10 A 100 ul. *

UND

1

1.050,00

1.500,00

1.650,00

1.500,00

202

B51800403

MICROPIPETA DE RANGO VARIABLE DE 100 A 1000 ul *

UND

2

1.050,00

1.500,00

1.650,00

3.000,00

203

B51800404

MICROPIPETA DE RANGO VARIABLE DE 20 - 200 ul *

UND

2

1.050,00

1.500,00

1.650,00

3.000,00

204

B51800405

MICROPIPETA GILSON P20

UND

1

686,00

980,00

1.078,00

980,00

205

B51800820

MICROTRITURADOR DE PELLET CON TUBOS DE 1.5 ml

UND

4

665,00

950,00

1.045,00

3.800,00

206

B35001200

NISTATINA, 10000 U/ML, 20 ML

FCO

2

140,00

200,00

220,00

400,00

207

B35782683

OVOALBUMINA x 200UL.

VLS

1

217,00

310,00

341,00

310,00

208

B51800441

PAPEL DE NITROCELULOSA 20 x 20 cm

RLL

2

161,00

230,00

253,00

460,00

209

B35001050

PAPEL IMPREGNADO CON CARBARYL AL 0.8%

CJA

6

77,00

110,00

121,00

660,00

210

B35001033

PAPEL IMPREGNADO CON MALATION AL 5%

CJA

6

77,00

110,00

121,00

660,00

211

B35001034

PAPEL IMPREGNADO CON PERMETRIN AL 0.75%

CJA

8

77,00

110,00

121,00

880,00

212

B35001049

PAPEL IMPREGNADO CON PROPOXUR AL 0.1%

CJA

2

77,00

110,00

121,00

220,00

213

B51800856

PAPEL IMPREGNADO EN ALFA CIPERMETRINA 0.1%

CJA

3

73,50

105,00

115,50

315,00

214

B51800857

PAPEL IMPREGNADO EN BETA CYFLUTRINA AL 0.1%

CJA

3

73,50

105,00

115,50

315,00

215

B51800861

PAPEL IMPREGNADO EN CARBARYL AL 5%

CJA

2

73,50

105,00

115,50

210,00

216

B51800855

PAPEL IMPREGNADO EN CIPERMETRINA AL 0.1%

CJA

3

73,50

105,00

115,50

315,00

217

B51800807

PAPEL IMPREGNADO EN CYFLUTHRIN AL 0.15%

CJA

7

65,80

94,00

103,40

658,00

218

B51800809

PAPEL IMPREGNADO EN DDT AL 4.0%

CJA

8

44,30

63,28

69,60

506,24

219

B51800815

PAPEL IMPREGNADO EN DELTAMETHRIN AL 0.05%

CJA

8

66,46

94,93

104,42

759,44

220

B51800862

PAPEL IMPREGNADO EN DELTAMETRINA AL 0.1%

CJA

4

73,50

105,00

115,50

420,00

221

B51800858

PAPEL IMPREGNADO EN LAMBDA CYLOTRINA AL 0.1%

CJA

4

73,50

105,00

115,50

420,00

222

B51800808

PAPEL IMPREGNADO EN LAMBDACYHALOTHRIN AL 0.05%

CJA

8

65,80

94,00

103,40

752,00

223

B51800859

PAPEL IMPREGNADO EN PERMETRINA AL 0.1%

CJA

4

73,50

105,00

115,50

420,00

224

B51800812

PAPEL IMPREGNADO EN PROPOXUR AL 0.1%

CJA

4

88,90

127,00

139,70

508,00

225

B51800860

PAPEL IMPREGNADO EN PROPOXUR AL 1%

CJA

2

73,50

105,00

115,50

210,00

226

B35782202

PARTICULAS DE LATEX POLIESTIRENO 0.22um, SUSPENSION AL 10% 5gr.

FCO

1

794,50

1.135,00

1.248,50

1.135,00

227

B35782204

PARTICULAS DE LATEX POLIESTIRENO 9.99um x 1.5gr, HIDROFOBICAS

FCO

1

794,50

1.135,00

1.248,50

1.135,00

228

B51800485

PEINE PARA ELECTROFORESIS PARA 10 HOYOS (POZOS) DE 0.75 mm. DE 8 cm DE LONGITUD *

UND

1

115,50

165,00

181,50

165,00

229

B35782227

PENTA-HIS HRP CONJUGATE KIT

VLS

1

1.260,00

1.800,00

1.980,00

1.800,00

230

B35782660

PERMETRINA x 100 mg.

FCO

3

206,94

295,62

325,18

886,86

231

B35780782

PERSULFATO DE AMONIO 98% x 100 g. PARA ELECTROFORESIS.

FCO

1

98,13

140,18

154,19

140,18

232

B35782604

PHORBOL 12-MYRISTATE 13 - ACETATE (PMA) x 1mg.

FCO

2

224,00

320,00

352,00

640,00

233

B51200197

PLACA D/POLIESTIRENO D/8 CANALES P/INMUNOBLOT C/TAPA 10.5 cm x 5 mm (Cja. 100 und)

CJA

1

140,00

200,00

220,00

200,00

234

B51100277

PLACA DE VIDRIO P/ELECTROFORESIS (SET 10) 10(7.3 x 10.2cm.) 10 (8.3 x 10.2cm).

SET

10

490,00

700,00

770,00

7.000,00

235

B51100279

PLACA DE VIDRIO P/ELECTROFORESIS INT./EXT. (SET. 24) *

SET

1

910,00

1.300,00

1.430,00

1.300,00

236

B51800805

PLACA PARA SECADO DE TIRAS REACTIVAS USADAS E PRUEBA DE FLUJO LATERAL, QUIM. INERTES SUPERFICIE DE LA PLACA BIO COMPATIBLE

UND

1

1.050,00

1.500,00

1.650,00

1.500,00

237

B35830638

PLASMIDO PCDNA N TERMINAL x 20 MG.

VLS

1

875,00

1.250,00

1.375,00

1.250,00

238

B35830637

PLASMIDO PVAX C TERMINAL x 20 MG

VLS

1

525,00

750,00

825,00

750,00

239

B35782602

POKEWEED MITOGEN (PWM) x 5ml.

FCO

2

49,00

70,00

77,00

140,00

240

B35782703

POLIACRILAMIDA PARA SECUENCIAMIENTO DE ADN (READY MIX DNA/PAGE)

FCO

3

372,40

532,00

585,20

1.596,00

241

B35681136

PRIMER 16SP0 5-AGA GTT TGA TCM TGG-3 x 200 nm

VLS

1

80,50

115,00

126,50

115,00

242

B35681137

PRIMER 16SPC5 5-TAC CTT GTT ACG ACT T-3 x 200 nm

VLS

1

98,00

140,00

154,00

140,00

243

B35680590

PRIMER 17K-1F 5'-GCT CTT GCA ACT TCT AGT TT-3'

VLS

2

101,50

145,00

159,50

290,00

244

B35680592

PRIMER 17K-2R: 5'-CAT TGT TCG TCA GGT TGG CG-3'

VLS

2

105,00

150,00

165,00

300,00

245

B35681155

PRIMER 3'-CS 5'-AAG CAG ACT TGA CCT GA-3' x 200 nm

VLS

1

84,00

120,00

132,00

120,00

246

B35681154

PRIMER 5' CS 5'-GGC ATC CAA GCA GCA AG-3' x 200 nm

VLS

1

84,00

120,00

132,00

120,00

247

B35681128

PRIMER A ESCALA DE SINTESIS 50 NMOL (BASE 20 DE DN)-P4R

VLS

2

147,00

210,00

231,00

420,00

248

B35681127

PRIMER A ESCALA DE SINTESIS 50 NMOL (BASE 20 DE DNA)-P4F

VLS

2

147,00

210,00

231,00

420,00

249

B35681126

PRIMER A ESCALA DE SINTESIS 50 NMOL (BASE 22 DE DNA)

VLS

2

147,00

210,00

231,00

420,00

250

B35681129

PRIMER A ESCALA DE SINTESIS 50 NMOL (BASE 26 DE DNA)

VLS

2

147,00

210,00

231,00

420,00

251

B35681131

PRIMER A ESCALA DE SINTESIS 50 NMOL (BASE 27 DE DNA)

VLS

2

147,00

210,00

231,00

420,00

252

B35681130

PRIMER A ESCALA DE SINTESIS 50 NMOL (BASE 29 DE DNA)

VLS

2

147,00

210,00

231,00

420,00

253

B35681104

PRIMER BBFLAG5,5'-TATTAATTTGGGTAGAGAACAG-3', 100 NM

VLS

1

108,50

155,00

170,50

155,00

254

B35681105

PRIMER BBFLAG6,5'-GACACCCTTTAAAATACCTTGAGT-3' 100 NM

VLS

1

119,00

170,00

187,00

170,00

255

B35681103

PRIMER BBLIPO5,5'-GGTTCACCGCCGCAAAATCTT-3', 100 NM

VLS

1

105,00

150,00

165,00

150,00

256

B35681102

PRIMER BBLIPO6, 5'-GTACCGGCCAACGCATCTT-3',100 NM

VLS

1

98,00

140,00

154,00

140,00

257

B35680712

PRIMER BFPB 5'AATggTgCTTgCgCTTgCTgC 3'x 250nm

VLS

1

105,00

150,00

165,00

150,00

258

B35680938

PRIMER BFPR 5'GCCGCTTTATCCAACCTGGTA 3'x 250nm

VLS

1

98,00

140,00

154,00

140,00

259

B35681151

PRIMER CTX-M3G-F 5-GTT ACA ATG TGT GAG AAG CAG x 200 nm

VLS

1

108,50

155,00

170,50

155,00

260

B35681152

PRIMER CTX-M3G-R 5-CCG TTT CCG CTA TTA CAA AC x 200 nm

VLS

1

98,00

140,00

154,00

140,00

261

B35681149

PRIMER CTX-MU1 5-ATG TGC AGY ACC AGT AAR GT -3' 200 nm

VLS

1

98,00

140,00

154,00

140,00

262

B35681150

PRIMER CTX-MU2 5-TGG GTR AAR TAR GTS ACC AGA-3' x 200 nm

VLS

1

108,50

155,00

170,50

155,00

263

B35680730

PRIMER EAEC AggRF 5' CTA ATT GTA CAA TCG ATG TA 3' x 250 nm

VLS

2

101,50

145,00

159,50

290,00

264

B35680731

PRIMER EAEC AggRR 5' AGA GTC CAT CTC TTT GAT AAG 3' x 250 nm

VLS

2

105,00

150,00

165,00

300,00

265

B35680732

PRIMER EAEC aapF 5' CTT GGG TAT CAG CCT GAA TG 3' x 250 nm

VLS

2

105,00

150,00

165,00

300,00

266

B35680733

PRIMER EAEC aapR 5' AAC CCA TTC GGT TAG AGC AC 3' x 250 nm

VLS

2

98,00

140,00

154,00

280,00

267

B35680215

PRIMER ERIC 15'-ATG TAA GCT CCT GGG GAT TCA C-3'

VLS

1

101,50

145,00

159,50

145,00

268

B35680998

PRIMER ERIC 1R 5'-ATG TAA GCT CCT GGG GAT TCA-3' x 200nm

VLS

1

105,00

150,00

165,00

150,00

269

B35680216

PRIMER ERIC 25'-AAG TAA GTG ACT GGG GTG AGA GCG-3'

VLS

1

119,00

170,00

187,00

170,00

270

B35680999

PRIMER ERIC2 5'-AAG TAA GTG ACT GGG GTG AGA GCG-3' x 200nm

VLS

1

105,00

150,00

165,00

150,00

271

B35681140

PRIMER GES-1A 5-ATG CGC TTC ATT CAC GCA C-3 x 200 nm

VLS

1

94,50

135,00

148,50

135,00

272

B35681135

PRIMER GES-1B 5-CTA TTT GTC CGT GCT CAG G-3 x 200 nm

VLS

1

73,50

105,00

115,50

105,00

273

B35681106

PRIMER HRPII-1,5'-AATTCCCATGGTTTCCTTCTC-3',100 NM

VLS

1

105,00

150,00

165,00

150,00

274

B35681107

PRIMER HRPII-2,5'-ATTTAATGGCGTAGGCAATGT-3', 100 NM

VLS

1

105,00

150,00

165,00

150,00

275

B35681108

PRIMER HRPII-4,5'-ATGATGAGCATGATGGGCATAG-3', 100 NM

VLS

1

108,50

155,00

170,50

155,00

276

B35681109

PRIMER HRPII-5,5'-ATGCTCATCATGCAGCCTATG-3', 100 NM

VLS

1

105,00

150,00

165,00

150,00

277

B35681110

PRIMER HRPII-6,5'-CGGTTGCATGGTGAGCATCAGT-3',100 NM

VLS

1

108,50

155,00

170,50

155,00

278

B35681146

PRIMER IMP-F 5-TGA GCA AGT TAT CTG TAT TC-3 x 200 nm

VLS

1

98,00

140,00

154,00

140,00

279

B35681147

PRIMER IMP-R 5-TTA GTT GCT TGG TTT TGA TG-3 x 200 nm

VLS

1

98,00

140,00

154,00

140,00

280

B35681133

PRIMER IS-F 5-GCG TAG GCG TCG GTG ACA AA-3 x 200 nm

VLS

1

98,00

140,00

154,00

140,00

281

B35681134

PRIMER IS-R 5-GCG TAG GCG TCG GTG ACA AA-3 x 200 nm

VLS

1

94,50

135,00

148,50

135,00

282

B35680640

PRIMER IS6110 INS-1 5'CgTgAgggCATCgAggTggC 3' x 250nm

VLS

1

101,50

145,00

159,50

145,00

283

B35680644

PRIMER IS6110 INS-2 5'gCgTAggCgTCggTgACAAA 3' x 250nm

VLS

1

101,50

145,00

159,50

145,00

284

B35680641

PRIMER M13-40 MARCADO CON cy5:5'-CgCCAgggTTTTCCCAgTCACgAC-3', 200 NANOMOLES

VLS

1

119,00

170,00

187,00

170,00

285

B35681111

PRIMER PFSEC-1,5'-AGCCTCGAATTCCTAGTTAATG CAAATATCTAC-3', 100 NM

VLS

1

161,00

230,00

253,00

230,00

286

B35681090

PRIMER PFSEC-10',5'-AAAAAGCAATTATGGGAAGC-3',100 NM

VLS

1

98,00

140,00

154,00

140,00

287

B35681091

PRIMER PFSEC-11, 5'-TTTTTAAACCGCCTCTACCT-3',100 NM

VLS

1

98,00

140,00

154,00

140,00

288

B35681112

PRIMER PFSEC-2,5'-GAGCTCGGATCCGAAGGAAG TAAGGTCTGAAGAA-3', 100 NM

VLS

1

168,00

240,00

264,00

240,00

289

B35681113

PRIMER PFSEC-3,5'-GAGCTCGGATCCGAGTAGACCAG GTAAATATCATTTC-3'

VLS

1

182,00

260,00

286,00

260,00

290

B35681114

PRIMER PFSEC-4,5'-AAGTTGTTTTATATCTCTGGGTTCC-3', 100 NM

VLS

1

126,00

180,00

198,00

180,00

291

B35681115

PRIMER PFSEC-5,5'-TGTTCTTTTATCATAGCATTCC-3',100 NM

VLS

1

108,50

155,00

170,50

155,00

292

B35681116

PRIMER PFSEC-6,5'-GAACCCCTCACTACCTCTCCT-3', 100 NM

VLS

1

105,00

150,00

165,00

150,00

293

B35681117

PRIMER PFSEC-7,5'-ATTTAGTTCCCCTTATATTCTTACCA-3',100 NM

VLS

1

129,50

185,00

203,50

185,00

294

B35681089

PRIMER PFSEC-8, 5'-AATTGATTTTGGCAGCACA-3', 100 NM

VLS

1

98,00

140,00

154,00

140,00

295

B35681088

PRIMER PFSEC-9',5'-ATCGTCTTCCATCAAACATACTC-3', 100 NM

VLS

1

119,00

170,00

187,00

170,00

296

B35681093

PRIMER PQE 5'-CGGATAACAATTTCACACAG-3', 100 NM

VLS

1

98,00

140,00

154,00

140,00

297

B35681092

PRIMER PQE 5'-GTTCTGAGGTCATTACTGG-3', 100 NM

VLS

1

98,00

140,00

154,00

140,00

298

B35680213

PRIMER REP1R-DT 5'-III ICG ICG ICA TCI GGC-3'

VLS

1

101,50

145,00

159,50

145,00

299

B35680218

PRIMER REP2-D 5'-ICG ICT TAT CIG GCC TAC-3' x 200nm

VLS

1

87,50

125,00

137,50

125,00

300

B35680643

PRIMER REVERSE MARCADO CON cy5:5'-TTTCACACAggAAACAgCTATgAC-3', 200 NANOMOLES

VLS

1

119,00

170,00

187,00

170,00

301

B35681122

PRIMER RF1396F-GEN ompBa 5'-ACC CAG AAC TCG AAC TTT GGT G-3'

VLS

2

108,50

155,00

170,50

310,00

302

B35681123

PRIMER RF1524R-GEN ompBa 5'-CAC ACC CGC AGT ATT ACC GTT-3'

VLS

2

105,00

150,00

165,00

300,00

303

B35681120

PRIMER RP2 5'-TTC ACG GCA ATA TTG ACC TGT ACT GTT CC-3'

VLS

2

143,50

205,00

225,50

410,00

304

B35681121

PRIMER RPID 5'-CGG TAC ACT TCT TGG TGG CGC AGG AGG T-3'

VLS

2

133,00

190,00

209,00

380,00

305

B35681124

PRIMER RR 190-70-GEN ompA 5'-ATG GCG AAT ATT TCT CCA AAA-3'

UND

2

105,00

150,00

165,00

300,00

306

B35681125

PRIMER RR 190-701-GEN ompA 5'-GTT CCG TTA ATG GCA GCA TCT-3'

VLS

2

105,00

150,00

165,00

300,00

307

B35681097

PRIMER RegionA1 5'CGCATCCGTCAGCGCTCCAA-3', 100 NM

VLS

1

98,00

140,00

154,00

140,00

308

B35681096

PRIMER RegionA2 5'-GCCAACTCTTGTCGTAGCCGC-3',100 NM

VLS

1

105,00

150,00

165,00

150,00

309

B35681101

PRIMER Rv2819_3A:3'-GATCGCTTGTTCTCAGTGCAG-5',100 NM

VLS

1

105,00

150,00

165,00

150,00

310

B35681100

PRIMER Rv2819_3B:3'-CGAAGGAGTACCACGTGGAG-5', 100 NM

VLS

1

98,00

140,00

154,00

140,00

311

B35681099

PRIMER Rv2819_4A:5'-GGTGCGAGATTGAGGTTCCC-3', 100 NM

VLS

1

98,00

140,00

154,00

140,00

312

B35681098

PRIMER Rv2819_4B:5'-TCTACCTGCAGTCGCTTGTGC-3', 100 NM

VLS

1

105,00

150,00

165,00

150,00

313

B35681153

PRIMER SHV TotF 5-GTA TTG AAT TCA TGC GTT ATA TTC GCC TGT GTA-3 x 200 nm

VLS

1

161,00

230,00

253,00

230,00

314

B35681139

PRIMER SHV TotR 5-CAG AAT TCG GCT AGC GTT GCC AGT GCT CGA T-3 x 200 nm

VLS

1

151,90

217,00

238,70

217,00

315

B35681142

PRIMER TEM-F 5-GAG TAT TCA ACA TTT CCG TGT C-3 x 200 nm

VLS

1

108,50

155,00

170,50

155,00

316

B35681148

PRIMER TEM-R 5-TAA TCA GTG AGG CAC CTA TCT C-3 x 200 nm

VLS

1

108,50

155,00

170,50

155,00

317

B35681118

PRIMER TZ15 5'-TTC TCA ATT CGG TAA GGG C-3'

VLS

2

98,00

140,00

154,00

280,00

318

B35681119

PRIMER TZ16 5'-ATA TTG ACC AGT CGC TAT TTC-3'

VLS

2

105,00

150,00

165,00

300,00

319

B35681138

PRIMER VEB1-A 5-CGA CTT CCA TTT CCC GAT GC-3 x 200 nm

VLS

1

98,00

140,00

154,00

140,00

320

B35681132

PRIMER VEB1-B 5-GGA CTC TGC AAC AAA TAC GC-3 x 200nm

VLS

1

98,00

140,00

154,00

140,00

321

B35681141

PRIMER VIM1-F 5-ATT GGT CTA TTT GAC CGC GTC -3 x 200 nm

VLS

1

105,00

150,00

165,00

150,00

322

B35681143

PRIMER VIM1-R 5-TGC TAC TCA ACG ACT GAG CG-3 x 200 nm

VLS

1

98,00

140,00

154,00

140,00

323

B35681144

PRIMER VIM2-F 5-AAA GTT ATG CCG CAC TCA CC-3 x 200 nm

VLS

1

98,00

140,00

154,00

140,00

324

B35681145

PRIMER VIM2-R 5-TGC AAC TTC ATG TTA TGC CG-3 x 200 nm

VLS

1

98,00

140,00

154,00

140,00

325

B35681095

PRIMER dnaA-dnaN-F 5-TCCGAGATGGCCGAGCGCCG-3', 100 NM

VLS

1

98,00

140,00

154,00

140,00

326

B35681094

PRIMER dnaN-R:5'-CCACCCACGACACCGCATCG-3',100 NM

VLS

1

98,00

140,00

154,00

140,00

327

B35782686

PROPOXUR x 1 gr. *

FCO

2

156,00

222,85

245,13

445,70

328

B51100454

PULVERIZADOR DE VIDRIO BOROSILICATO COMPLETO x 10 ml ESMIRILADO

UND

3

67,20

96,00

105,60

288,00

329

B35782615

REACTIVO A VOGES-PROSKAUER x 50 DISPENSADORES DE 0.75mL c/u (ALFA NAFTOL).

CJA

2

315,00

450,00

495,00

900,00

330

B35780883

REACTIVO DE LATEX DE REFERNCIA PARA HIDATIDOSIS (OPS)

FCO

5

273,00

390,00

429,00

1.950,00

331

B35780853

REACTIVO FOLIN Y CIOCALTEUS x 1 lt.

FCO

2

864,50

1.234,99

1.358,48

2.469,98

332

B35780852

REACTIVO FOLIN Y CIOCALTEUS x 100 ml. *

FCO

2

107,10

153,00

168,30

306,00

333

B35782141

RENOGRAFINA 76: DIATRIZOATE MEGLUMINE 66%, DIATRIZOATE DE SODIO 10% (Fco x 100ml)

FCO

1

700,00

1.000,00

1.100,00

1.000,00

334

B35830755

SARCOSYL (N-LAUROYLSARCOSINE SODIUM SALT) x 250g

FCO

1

257,60

368,00

404,80

368,00

335

B35782463

SDS (10%) GRADO BIOLOGIA MOLECULAR x 250 ML

FCO

1

249,17

355,95

391,54

355,95

336

B35782771

SEPHADEX G 100 x 100g.

FCO

1

1.239,00

1.770,00

1.947,00

1.770,00

337

B35782776

SEPHADEX G-25 x 500g.

FCO

1

1.239,00

1.770,00

1.947,00

1.770,00

338

B35782780

SEPHADEX G-50 (SUPERFINO)x 100g

FCO

1

1.239,00

1.770,00

1.947,00

1.770,00

339

B35782959

SOLUCION 0.25% TRIPSINA 1 mM EDTA (1 X), 100 ML

FCO

5

126,00

180,00

198,00

900,00

340

B35001280

SOLUCION PENICILINA-ESTREPTOMICINA 100 x(1000 U/ML PENICILINA Y 10 MG/ML ESTREPTOMICINA), 20 ML

FCO

2

119,00

170,00

187,00

340,00

341

B51200226

SOPORTE DE TIRAS DE 8 POZOS ELISA x 60

PQT

2

175,00

250,00

275,00

500,00

342

B35530829

SUERO CONTROL DE CANDIDA ALBICANS x 1ml.

VLS

1

1.400,00

2.000,00

2.200,00

2.000,00

343

B35530831

SUERO CONTROL DE COCCIDIOIDES IMMITIS x 1ml.

VLS

1

1.400,00

2.000,00

2.200,00

2.000,00

344

B35530830

SUERO CONTROL DE HISTOPLASMA PARA INMUNODIFUSION x 1 Ml. HISTOPLASMA ID SERUM CONTROL *

FCO

2

1.400,00

2.000,00

2.200,00

4.000,00

345

B35530832

SUERO CONTROL DE PARACOCCIDIOIDES PARA INMUNODIFUSION x 1ml.

VLS

1

155,55

222,21

244,43

222,21

346

B35530878

SUERO PARA CONTROL DE CALIDAD DE PRUEBAS RAPIDAS

FCO

1

840,00

1.200,00

1.320,00

1.200,00

347

B51100547

TANQUE CILINDRICO DE VIDRIO BOROSILICATO CON TAPA, PARA REVELADO DE PLACAS CROMATOGRAFICAS

UND

3

336,00

480,00

528,00

1.440,00

348

B47035312

TARJETA FTA PARA IMPREGNAR MANCHAS DE SANGRE FTA GENE CARD x 100 Und.

CJA

1

928,20

1.326,00

1.458,60

1.326,00

349

B35780574

TARTRATO DE SODIO DIHIDRATADO x 100g.

FCO

1

126,00

180,00

198,00

180,00

350

B51200433

TUBO AL VACIO DE PLASTICO PARA COLECTA DE 2 ML DE SANGRE C/ANTICOAGULANTE EDTA, CJA x 100

CJA

8

77,00

110,00

121,00

880,00

351

B51200434

TUBO AL VACIO DE PLASTICO PARA COLECTA DE 8 ML DE SANGRE C/ANTICOAGULANTE HEPARINA Y GEL SEPARADOR DE LINFOCITOS, CJA x 100

CJA

2

77,00

110,00

121,00

220,00

352

B51100388

TUBO PARA CENTRIFUGA SORVALL C/TAPA ROSCA, 28.5mm Diam.,104mm LARGO,50mL *

DOC

2

217,00

310,00

341,00

620,00

353

B51200352

TUBO PARA MICROCENTRIFUGA DE POLIPROPILENO PARA PCR 0.2 mL (PQT. x 1000)

PQT

23

101,50

145,00

159,50

3.335,00

354

B51800771

VECTOR PARA CLONAMIENTO LAMBDA EXCELL NOT L/ECOR I/CIAP, 10 MICROGRAMOS

KIT

1

1.827,00

2.610,00

2.871,00

2.610,00

355

B35120904

VIRUS VACCINA MODIFICADO CEPA ANKARA ATCC VR-1508

VLS

1

861,00

1.230,00

1.353,00

1.230,00


1   2   3   4   5   6   7


La base de datos está protegida por derechos de autor ©bazica.org 2016
enviar mensaje

    Página principal